ID: 1140293299_1140293307

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1140293299 1140293307
Species Human (GRCh38) Human (GRCh38)
Location 16:73684657-73684679 16:73684703-73684725
Sequence CCAGATTATCTGCATGTGCCCCT TTTTTTTTTTTTTTTGGAGATGG
Strand - +
Off-target summary No data {0: 2676, 1: 87395, 2: 67301, 3: 106475, 4: 184656}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!