ID: 1140293304_1140293308

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1140293304 1140293308
Species Human (GRCh38) Human (GRCh38)
Location 16:73684677-73684699 16:73684724-73684746
Sequence CCTGCAATCACAAGGGTCCTTTT GGAGTCTTGCTCTGTCACCCAGG
Strand - +
Off-target summary No data {0: 11170, 1: 44232, 2: 101511, 3: 128684, 4: 136249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!