ID: 1140322527_1140322532

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1140322527 1140322532
Species Human (GRCh38) Human (GRCh38)
Location 16:73967038-73967060 16:73967070-73967092
Sequence CCACCACCAGGGTCCCGGGGGAC TCTACATATCAAACAGCAGTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!