ID: 1140504820_1140504826

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1140504820 1140504826
Species Human (GRCh38) Human (GRCh38)
Location 16:75464601-75464623 16:75464628-75464650
Sequence CCCGTCGCCATTCACCACAGAGA AGGGACGAGCGCCCGAAGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 113} {0: 1, 1: 0, 2: 1, 3: 1, 4: 38}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!