ID: 1140581857_1140581860

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1140581857 1140581860
Species Human (GRCh38) Human (GRCh38)
Location 16:76240326-76240348 16:76240357-76240379
Sequence CCTGGGTGATGAAATAATCTGTA CCCCATGACAAAGTTTACCTAGG
Strand - +
Off-target summary {0: 1444, 1: 2298, 2: 2506, 3: 2111, 4: 1760} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!