ID: 1140721978_1140721983

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1140721978 1140721983
Species Human (GRCh38) Human (GRCh38)
Location 16:77780312-77780334 16:77780342-77780364
Sequence CCAACCAACTGGATATAGGCCAA ATAAAAGGAACAAAACTTTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 65, 4: 616}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!