ID: 1140734787_1140734797

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1140734787 1140734797
Species Human (GRCh38) Human (GRCh38)
Location 16:77888682-77888704 16:77888726-77888748
Sequence CCTCTACTCCCGTACCGCCAGCG AGACATTGTCAAATGTCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 37} {0: 11, 1: 139, 2: 434, 3: 873, 4: 1455}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!