ID: 1140734790_1140734798

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1140734790 1140734798
Species Human (GRCh38) Human (GRCh38)
Location 16:77888690-77888712 16:77888727-77888749
Sequence CCCGTACCGCCAGCGGTGGCAAT GACATTGTCAAATGTCTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 20} {0: 7, 1: 132, 2: 358, 3: 796, 4: 1201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!