ID: 1140967039_1140967045

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1140967039 1140967045
Species Human (GRCh38) Human (GRCh38)
Location 16:79976957-79976979 16:79977009-79977031
Sequence CCACATTCTAAACTCTTCCTCTG TAACCACCACCCCATTGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 420} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!