ID: 1140991786_1140991795

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1140991786 1140991795
Species Human (GRCh38) Human (GRCh38)
Location 16:80219996-80220018 16:80220045-80220067
Sequence CCAACCAGCTTAAAAAACGGCAC CTTGGAGGGACCTAGACCCAAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 66, 3: 601, 4: 1925}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!