ID: 1141045869_1141045874

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1141045869 1141045874
Species Human (GRCh38) Human (GRCh38)
Location 16:80715761-80715783 16:80715788-80715810
Sequence CCTTCACCTTCCATCTCCTCCTC TCTGCCCTGCAGCCACTCTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 33, 3: 409, 4: 2959} {0: 1, 1: 0, 2: 1, 3: 20, 4: 257}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!