ID: 1141108626_1141108628

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1141108626 1141108628
Species Human (GRCh38) Human (GRCh38)
Location 16:81253928-81253950 16:81253947-81253969
Sequence CCTTAGCCTGGTGACAGCAAGAC AGACCCTGTCTCACAAAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 15, 4: 175} {0: 1, 1: 21, 2: 214, 3: 706, 4: 1341}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!