ID: 1141115681_1141115684

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1141115681 1141115684
Species Human (GRCh38) Human (GRCh38)
Location 16:81307036-81307058 16:81307068-81307090
Sequence CCTTCCGGCTTCTGCTTTCAAGT GCCTCAGCCTCCCGAGTTGCTGG
Strand - +
Off-target summary No data {0: 542, 1: 98232, 2: 265758, 3: 289060, 4: 316566}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!