ID: 1141115681_1141115686

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1141115681 1141115686
Species Human (GRCh38) Human (GRCh38)
Location 16:81307036-81307058 16:81307069-81307091
Sequence CCTTCCGGCTTCTGCTTTCAAGT CCTCAGCCTCCCGAGTTGCTGGG
Strand - +
Off-target summary No data {0: 588, 1: 104191, 2: 295057, 3: 336636, 4: 348616}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!