ID: 1141115681_1141115688

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1141115681 1141115688
Species Human (GRCh38) Human (GRCh38)
Location 16:81307036-81307058 16:81307077-81307099
Sequence CCTTCCGGCTTCTGCTTTCAAGT TCCCGAGTTGCTGGGATTACAGG
Strand - +
Off-target summary No data {0: 270, 1: 46582, 2: 223063, 3: 576901, 4: 432749}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!