ID: 1141284689_1141284695

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1141284689 1141284695
Species Human (GRCh38) Human (GRCh38)
Location 16:82660555-82660577 16:82660584-82660606
Sequence CCCGAGGCCAGAGATGAAGTGAA ATGACAACCTAGGGCCCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 297} {0: 1, 1: 0, 2: 1, 3: 7, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!