ID: 1141284691_1141284695

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1141284691 1141284695
Species Human (GRCh38) Human (GRCh38)
Location 16:82660562-82660584 16:82660584-82660606
Sequence CCAGAGATGAAGTGAAAGAAAGA ATGACAACCTAGGGCCCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 729} {0: 1, 1: 0, 2: 1, 3: 7, 4: 109}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!