ID: 1141400489_1141400497

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1141400489 1141400497
Species Human (GRCh38) Human (GRCh38)
Location 16:83742879-83742901 16:83742918-83742940
Sequence CCTTGAGGTCTCCCATGGGAGGA AGCAAACTGGCCAGGTGCGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 15, 4: 152} {0: 1, 1: 18, 2: 162, 3: 1349, 4: 7653}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!