ID: 1141482830_1141482834

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1141482830 1141482834
Species Human (GRCh38) Human (GRCh38)
Location 16:84318298-84318320 16:84318313-84318335
Sequence CCTCGATGGCTTGGTGGCAATGG GGCAATGGCTGGCTCCTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 85} {0: 1, 1: 0, 2: 2, 3: 23, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!