ID: 1141482830_1141482838

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1141482830 1141482838
Species Human (GRCh38) Human (GRCh38)
Location 16:84318298-84318320 16:84318334-84318356
Sequence CCTCGATGGCTTGGTGGCAATGG GGCCCTGAGGAGGTGTTACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 85} {0: 1, 1: 0, 2: 2, 3: 19, 4: 136}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!