ID: 1141649806_1141649814

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1141649806 1141649814
Species Human (GRCh38) Human (GRCh38)
Location 16:85386867-85386889 16:85386890-85386912
Sequence CCATTCCTGGGGTGCCTCTTGGG GTGGCCCTGGCTGCTGGCTTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 49, 4: 369}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!