ID: 1141776214_1141776224

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1141776214 1141776224
Species Human (GRCh38) Human (GRCh38)
Location 16:86124137-86124159 16:86124187-86124209
Sequence CCAGGCGTGGTGGCATGCACCCG CAGAAGAATTACTTGAAGTCGGG
Strand - +
Off-target summary {0: 12, 1: 900, 2: 9194, 3: 32279, 4: 78843} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!