ID: 1141776217_1141776224

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1141776217 1141776224
Species Human (GRCh38) Human (GRCh38)
Location 16:86124156-86124178 16:86124187-86124209
Sequence CCCGTAGTCCCAGCTACTTGGGA CAGAAGAATTACTTGAAGTCGGG
Strand - +
Off-target summary {0: 41425, 1: 153414, 2: 219429, 3: 225665, 4: 454725} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!