ID: 1141910423_1141910427

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1141910423 1141910427
Species Human (GRCh38) Human (GRCh38)
Location 16:87054831-87054853 16:87054857-87054879
Sequence CCTGCTGTCTTTGAAGACGAAGG GGGCCATGAGCCAAAGAATGAGG
Strand - +
Off-target summary No data {0: 6, 1: 67, 2: 208, 3: 326, 4: 618}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!