ID: 1141972436_1141972460

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1141972436 1141972460
Species Human (GRCh38) Human (GRCh38)
Location 16:87492723-87492745 16:87492773-87492795
Sequence CCTCCGCCCAGGCCGGCCGTTAC CTGGGGAGCGCTGGGGGCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 77} {0: 1, 1: 0, 2: 7, 3: 89, 4: 739}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!