ID: 1142000418_1142000428

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1142000418 1142000428
Species Human (GRCh38) Human (GRCh38)
Location 16:87661172-87661194 16:87661213-87661235
Sequence CCAGCGGGGCAGCCTCTCCTCTC CCCTCTTACAAGGACCCTTGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 32, 4: 328} {0: 1, 1: 9, 2: 11, 3: 36, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!