ID: 1142000419_1142000430

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1142000419 1142000430
Species Human (GRCh38) Human (GRCh38)
Location 16:87661184-87661206 16:87661218-87661240
Sequence CCTCTCCTCTCCTCTCCGACCTC TTACAAGGACCCTTGTGGTTCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 18, 3: 259, 4: 2045} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!