ID: 1142000423_1142000432

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1142000423 1142000432
Species Human (GRCh38) Human (GRCh38)
Location 16:87661203-87661225 16:87661220-87661242
Sequence CCTCCTGCCTCCCTCTTACAAGG ACAAGGACCCTTGTGGTTCGGGG
Strand - +
Off-target summary {0: 4, 1: 41, 2: 157, 3: 395, 4: 1372} {0: 1, 1: 0, 2: 1, 3: 3, 4: 58}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!