ID: 1142029922_1142029935

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1142029922 1142029935
Species Human (GRCh38) Human (GRCh38)
Location 16:87833373-87833395 16:87833408-87833430
Sequence CCCGGGCCACCACCTGGACACAT CACAGCAGGCAGGGCCGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 22, 4: 228} {0: 1, 1: 0, 2: 1, 3: 39, 4: 487}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!