ID: 1142033589_1142033593

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1142033589 1142033593
Species Human (GRCh38) Human (GRCh38)
Location 16:87850499-87850521 16:87850531-87850553
Sequence CCAGAGCGTGCATCCGCCGGGTG AGCGAAAGCTCCACAGCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 31} {0: 1, 1: 0, 2: 0, 3: 8, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!