ID: 1142149987_1142149994

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1142149987 1142149994
Species Human (GRCh38) Human (GRCh38)
Location 16:88508488-88508510 16:88508510-88508532
Sequence CCACAGGCCTTGGGCTCCACGTG GGGTTCCCCTGGTCTCTCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 16, 4: 252} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!