ID: 1142197396_1142197399

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1142197396 1142197399
Species Human (GRCh38) Human (GRCh38)
Location 16:88745141-88745163 16:88745154-88745176
Sequence CCACCTCCGCAGGGACCCACTGC GACCCACTGCTGCCTCTTCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 47, 4: 419}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!