ID: 1142328223_1142328233

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1142328223 1142328233
Species Human (GRCh38) Human (GRCh38)
Location 16:89432381-89432403 16:89432411-89432433
Sequence CCATCGCCGTGGCAGCCGCCTCC CGTGGCATGCACTGTGTTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 369} {0: 1, 1: 0, 2: 2, 3: 6, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!