ID: 1142328226_1142328234

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1142328226 1142328234
Species Human (GRCh38) Human (GRCh38)
Location 16:89432396-89432418 16:89432412-89432434
Sequence CCGCCTCCCAGAGCCCGTGGCAT GTGGCATGCACTGTGTTGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 303} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!