ID: 1142428597_1142428601

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1142428597 1142428601
Species Human (GRCh38) Human (GRCh38)
Location 16:90013815-90013837 16:90013831-90013853
Sequence CCAGTGAGCAGTGCGGGGCTGTG GGCTGTGCTCCCATTTTAGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 277} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!