ID: 1142508444_1142508453

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1142508444 1142508453
Species Human (GRCh38) Human (GRCh38)
Location 17:380527-380549 17:380545-380567
Sequence CCCCCCTCATCCCTCCCGGAAGC GAAGCCCTCCTCATCCCTCCCGG
Strand - +
Off-target summary {0: 4, 1: 23, 2: 17, 3: 87, 4: 5618} {0: 14, 1: 14, 2: 15, 3: 46, 4: 381}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!