|
Left Crispr |
Right Crispr |
Crispr ID |
1142528865 |
1142528870 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:565208-565230
|
17:565240-565262
|
Sequence |
CCTGACCAACATAGAGAAACCCC |
AAAAACACAAAAAATTAGCCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 457, 1: 14037, 2: 38745, 3: 124583, 4: 205796} |
{0: 1984, 1: 54984, 2: 65457, 3: 54187, 4: 93581} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|