|
Left Crispr |
Right Crispr |
| Crispr ID |
1142528866 |
1142528874 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:565213-565235
|
17:565252-565274
|
| Sequence |
CCAACATAGAGAAACCCCGTCTT |
AATTAGCCAGGCGTGGTGGCGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 5, 1: 556, 2: 13214, 3: 76431, 4: 159952} |
{0: 10854, 1: 43830, 2: 75611, 3: 71380, 4: 47791} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|