ID: 1142528869_1142528873

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1142528869 1142528873
Species Human (GRCh38) Human (GRCh38)
Location 17:565229-565251 17:565251-565273
Sequence CCGTCTTCACTAAAAACACAAAA AAATTAGCCAGGCGTGGTGGCGG
Strand - +
Off-target summary {0: 8, 1: 633, 2: 18905, 3: 215866, 4: 134925} {0: 11026, 1: 40196, 2: 61434, 3: 51156, 4: 27800}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!