|
Left Crispr |
Right Crispr |
| Crispr ID |
1142528869 |
1142528874 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:565229-565251
|
17:565252-565274
|
| Sequence |
CCGTCTTCACTAAAAACACAAAA |
AATTAGCCAGGCGTGGTGGCGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8, 1: 633, 2: 18905, 3: 215866, 4: 134925} |
{0: 10854, 1: 43830, 2: 75611, 3: 71380, 4: 47791} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|