ID: 1142528869_1142528876

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1142528869 1142528876
Species Human (GRCh38) Human (GRCh38)
Location 17:565229-565251 17:565275-565297
Sequence CCGTCTTCACTAAAAACACAAAA TGCCTGTAATCCCAGCTACTCGG
Strand - +
Off-target summary {0: 8, 1: 633, 2: 18905, 3: 215866, 4: 134925} {0: 52453, 1: 101789, 2: 153905, 3: 227834, 4: 315316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!