ID: 1142541164_1142541171

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1142541164 1142541171
Species Human (GRCh38) Human (GRCh38)
Location 17:660631-660653 17:660651-660673
Sequence CCCTTGGGGAAGGACGAGGGCCC CCCCTGGGTGCTGCTGGGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 133} {0: 2, 1: 1, 2: 7, 3: 68, 4: 509}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!