ID: 1142541173_1142541182

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1142541173 1142541182
Species Human (GRCh38) Human (GRCh38)
Location 17:660653-660675 17:660693-660715
Sequence CCTGGGTGCTGCTGGGTGTGGTG GAGGGCCCCTGGGTGCTGCTGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 9, 3: 73, 4: 579} {0: 2, 1: 0, 2: 4, 3: 33, 4: 346}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!