ID: 1142637292_1142637300

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1142637292 1142637300
Species Human (GRCh38) Human (GRCh38)
Location 17:1265891-1265913 17:1265939-1265961
Sequence CCTGCCACAATGCCCGGCTAATT TTTCACCACGTTAGCCAGGATGG
Strand - +
Off-target summary {0: 113, 1: 8920, 2: 49144, 3: 81282, 4: 72719} {0: 686, 1: 22179, 2: 79780, 3: 158316, 4: 169814}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!