ID: 1142668697_1142668705

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1142668697 1142668705
Species Human (GRCh38) Human (GRCh38)
Location 17:1477471-1477493 17:1477488-1477510
Sequence CCCTTGCCCCCAGCAGCCCCGCA CCCGCAGCCCCACTCACGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 404} {0: 1, 1: 0, 2: 1, 3: 11, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!