ID: 1142668697_1142668711

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1142668697 1142668711
Species Human (GRCh38) Human (GRCh38)
Location 17:1477471-1477493 17:1477500-1477522
Sequence CCCTTGCCCCCAGCAGCCCCGCA CTCACGTCAGGAAGTGTGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 30, 4: 404} {0: 1, 1: 0, 2: 0, 3: 5, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!