ID: 1142668710_1142668713

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1142668710 1142668713
Species Human (GRCh38) Human (GRCh38)
Location 17:1477497-1477519 17:1477534-1477556
Sequence CCACTCACGTCAGGAAGTGTGGA ATCCTCCAGCTTCTCCAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 69} {0: 1, 1: 0, 2: 4, 3: 34, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!