ID: 1142673386_1142673391

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1142673386 1142673391
Species Human (GRCh38) Human (GRCh38)
Location 17:1498003-1498025 17:1498020-1498042
Sequence CCCCTCAGAGACAAGGAGAAGTG GAAGTGTGACGCCGGCGGTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 337} {0: 1, 1: 0, 2: 0, 3: 1, 4: 18}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!