|
Left Crispr |
Right Crispr |
Crispr ID |
1142815521 |
1142815526 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:2422019-2422041
|
17:2422049-2422071
|
Sequence |
CCAATGGCACCTGCCGGGCGCGG |
TGCTTGTAATCCTAGCACTCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 0, 2: 0, 3: 9, 4: 75} |
{0: 7, 1: 788, 2: 16259, 3: 126592, 4: 255579} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|