ID: 1142841269_1142841274

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1142841269 1142841274
Species Human (GRCh38) Human (GRCh38)
Location 17:2632797-2632819 17:2632830-2632852
Sequence CCTACACCATTTTTTATCAGGGA CTCGGATACCAAAATCCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 6, 3: 44, 4: 376} {0: 1, 1: 0, 2: 0, 3: 6, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!